View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18852_low_39 (Length: 226)
Name: NF18852_low_39
Description: NF18852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18852_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 22 - 210
Target Start/End: Original strand, 36109170 - 36109356
Alignment:
| Q |
22 |
taagttaaatctgacggctcaagtaaaacattcatgaaactgatctcaacttt-caaatttatctaacaaacaaaattattataactgcagtgaaaaatg |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36109170 |
taagttaaatctgacggctcaagtaaaacattcatgaaactgatctcaacttttcaaatttatctaacaaacaaaatta---taactgcagtgaaaaatg |
36109266 |
T |
|
| Q |
121 |
atcagatgccaaatatcagtccacagtaccaagcagatacttctaaaaattattaatactatcgacatcaatcagcaaataagttatttt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36109267 |
atcagatgccaaatatcagtccacagtaccaagcagatacttctgaaaattattaatactatcgacatcaatcagcaaataagttgtttt |
36109356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 192
Target Start/End: Original strand, 36101992 - 36102030
Alignment:
| Q |
154 |
cagatacttctaaaaattattaatactatcgacatcaat |
192 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
36101992 |
cagatacttttaaaaattattaattctatcgacatcaat |
36102030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University