View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18852_low_6 (Length: 534)
Name: NF18852_low_6
Description: NF18852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18852_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 2e-41; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 198 - 284
Target Start/End: Original strand, 18887615 - 18887701
Alignment:
| Q |
198 |
caagatttgtaaaatacttcaataatggactgttcaaaatcttaacttgttataaacacaaactttagaaggagatgactttttatc |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18887615 |
caagatttgtaaaatacttcaataatggactgttcaaaatcttaacttgttataaacacaaactttagaaggagatgactttttatc |
18887701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 292 - 379
Target Start/End: Original strand, 18887728 - 18887813
Alignment:
| Q |
292 |
gttgaatccatggctctaagagtgagttgtttttccctggtcttggaatcatggtcggaaagtagtcttaggacaaacttttcatgat |
379 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| | || ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18887728 |
gttgaatccatggccctaagagtgagttgttt--cactagtcttggaatcatggtcggaaagtagtcttatgacaaacttttcatgat |
18887813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 38 - 161
Target Start/End: Original strand, 18887500 - 18887614
Alignment:
| Q |
38 |
taatcgttatcttttgaataaag-ccttgttcctttcggacaattgcgaaacccattgagatacattcttcnnnnnnnncttccaaatatcttatgaaca |
136 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| || ||||||||||||||||| |
|
|
| T |
18887500 |
taatctttatcttttgaataaaggccttgttcctttcggacaattgcgaaaccc---gagatacattctt-------tcttttcaaatatcttatgaaca |
18887589 |
T |
|
| Q |
137 |
taatgagcacggttgttataatgag |
161 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
18887590 |
taatgagcacggttgttataatgag |
18887614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 18887435 - 18887489
Alignment:
| Q |
1 |
gtacacaagtgggattaaatcgcgacagagaagttaataatcgttatcttttgaa |
55 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18887435 |
gtacacaagtggtattaaattccgacagagaagttaataatcgttatcttttgaa |
18887489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University