View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18853_low_7 (Length: 213)
Name: NF18853_low_7
Description: NF18853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18853_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 18 - 197
Target Start/End: Original strand, 9466797 - 9466976
Alignment:
| Q |
18 |
attcattgtgctggttattnnnnnnntcatcaaagagagacatgttttacgctgttcatatacttttaggacaatgacttcttttattttgttctttagc |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9466797 |
attcattgtgctggttattaaaaaaatcatcaaagagagatatgttttacgctgttcatatacttttaggacaatgacttcttttattttgttctttagc |
9466896 |
T |
 |
| Q |
118 |
atctcaaatctcaattcataaaaacatgcatttggcaacattttcagtttgaacgctttttacatcacatgatcgaggtg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
9466897 |
atctcaaatctcaattcataaaaacatgcatttggcaacattttcagtttgaactctttttacatcacatgaacgaggtg |
9466976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 44 - 197
Target Start/End: Original strand, 5724487 - 5724633
Alignment:
| Q |
44 |
tcatcaaagagagacatgttttacgctgttcatatacttttaggacaatgacttcttttattttgttctttagcatctcaaatctcaattcataaaaaca |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5724487 |
tcatcaaagagagacatgttttacgctgttcatatacttttaggacaatgatttcttttattttgttctttagc-------atctcaattcataaaaaca |
5724579 |
T |
 |
| Q |
144 |
tgcatttggcaacattttcagtttgaacgctttttacatcacatgatcgaggtg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
5724580 |
tgcatttggcaacattttcagtttgaactctttttacatcacatgaacgaggtg |
5724633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University