View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18854_high_7 (Length: 227)

Name: NF18854_high_7
Description: NF18854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18854_high_7
NF18854_high_7
[»] chr4 (1 HSPs)
chr4 (4-67)||(37715344-37715405)
[»] chr1 (1 HSPs)
chr1 (1-62)||(8265604-8265663)


Alignment Details
Target: chr4 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 4 - 67
Target Start/End: Complemental strand, 37715405 - 37715344
Alignment:
4 gttgattgttcaacgatttttcagaacatgtaattgggtaaatgacaattgtagagtatatata 67  Q
    |||||||||||||||||||  |||||||||||||||||||||||||||||| | ||||||||||    
37715405 gttgattgttcaacgattt--cagaacatgtaattgggtaaatgacaattgcaaagtatatata 37715344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 8265663 - 8265604
Alignment:
1 taggttgattgttcaacgatttttcagaacatgtaattgggtaaatgacaattgtagagtat 62  Q
    ||||||||||||||||| ||||  ||||||||||||   |||||||||||||||| ||||||    
8265663 taggttgattgttcaacaattt--cagaacatgtaaaatggtaaatgacaattgtggagtat 8265604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University