View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18854_high_8 (Length: 220)
Name: NF18854_high_8
Description: NF18854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18854_high_8 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 24 - 220
Target Start/End: Original strand, 37525966 - 37526172
Alignment:
| Q |
24 |
ccactgttatgtagtatttgtgttattatttgcctttcatttcaattcaattcaagtaaatgaaaaaagcatctccctcactc----------tctttta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
37525966 |
ccactgttatgtagtatttgtgttattatttgcctttcatttcaattcaattcaagtaaatgaaaaaagcatctccctctctccctcactctttctttta |
37526065 |
T |
 |
| Q |
114 |
cgtacaacacctcactctcagggcccctttctttatcatcttcatgttcattcaaccactcaactcaatcttaaaaaactaacaataaatcaatcactca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37526066 |
cgtacaacacctcactctcagggcccctttctttatcatcttcatgttcattcaaccactcaactcaatcttaaaaaactaacaataaatcaatcactca |
37526165 |
T |
 |
| Q |
214 |
cacattc |
220 |
Q |
| |
|
||||||| |
|
|
| T |
37526166 |
cacattc |
37526172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 37528720 - 37528688
Alignment:
| Q |
1 |
tgaatttttattttaccttctctccactgttat |
33 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
37528720 |
tgaatttttattttaccttctctctactgttat |
37528688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University