View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18854_low_4 (Length: 359)
Name: NF18854_low_4
Description: NF18854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18854_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 72 - 341
Target Start/End: Original strand, 15069249 - 15069517
Alignment:
| Q |
72 |
atagtttctacaagtatatagggtttatttacattgtgggattgcaattctatggatatcttgatctctgccatggtgaattatgtcttaattttggagg |
171 |
Q |
| |
|
|||| |||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15069249 |
ataggttctacaagtatatggggtttacttacattgtgggattgcaattctatggatatcttgatctctgccatggtgaatcatgtcttaattttggagg |
15069348 |
T |
 |
| Q |
172 |
gtttttgatattgaagtcaaaagcaaattatgttttgtatgcttccatatattcaattcttatattcaatcttctttatatgcgacgttttgcactatnn |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15069349 |
gtttttgatattgaagtcaaaagcaaattatgttttgtttgcttccatatattctattcttatattcaatctt-tttatatgcgacgttttgcactataa |
15069447 |
T |
 |
| Q |
272 |
nnnnnnnnnnnnnttgttctttgttccacgaatgccactataagattccctgctgtaacagcagggtgct |
341 |
Q |
| |
|
|||||||||||||||| ||| |||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
15069448 |
aaaaataaaaaaattgttctttgttccacaaataccactataggattccctgctgtaacaacagggtgct |
15069517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 13 - 47
Target Start/End: Original strand, 15069196 - 15069230
Alignment:
| Q |
13 |
attctatttgtgaaatactttggaggtagaaagag |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
15069196 |
attctatttgtgaaatactttggaggtagaaagag |
15069230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University