View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18854_low_8 (Length: 227)
Name: NF18854_low_8
Description: NF18854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18854_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 4 - 67
Target Start/End: Complemental strand, 37715405 - 37715344
Alignment:
| Q |
4 |
gttgattgttcaacgatttttcagaacatgtaattgggtaaatgacaattgtagagtatatata |
67 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
37715405 |
gttgattgttcaacgattt--cagaacatgtaattgggtaaatgacaattgcaaagtatatata |
37715344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 8265663 - 8265604
Alignment:
| Q |
1 |
taggttgattgttcaacgatttttcagaacatgtaattgggtaaatgacaattgtagagtat |
62 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||| |||||||||||||||| |||||| |
|
|
| T |
8265663 |
taggttgattgttcaacaattt--cagaacatgtaaaatggtaaatgacaattgtggagtat |
8265604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University