View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18855_high_7 (Length: 383)
Name: NF18855_high_7
Description: NF18855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18855_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 10 - 355
Target Start/End: Complemental strand, 52432556 - 52432211
Alignment:
| Q |
10 |
ataattctaccatttgtgtgaaggagaatccgatgatgagtttcatatannnnnnnnccaattctgagcagacccgtgactggagggccgcatgtttgac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52432556 |
ataattctaccatttgtgtgaaggagaatccgatgatgagtttcatattttttttttccaattctgagcagacccgtgactggagggccgcatgtttgac |
52432457 |
T |
|
| Q |
110 |
caatgttttgcaacacattggctcagtttagcacttatgcagaattgttatatttgcaaattgcaagcatgagtattgtatcatagcagggtgggttgct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52432456 |
caatgttttgcaacacattggctcagtttagcacttatgcagaatttttatatttgcaaattgcaagcatgagtattgtatcatagcagggtgggttgct |
52432357 |
T |
|
| Q |
210 |
atgctcttgtggtgcatttggaataacaacaggcaacccccaaatcaggttggtaagcaaaattttaacttgtgggaacctggtatgcttggttcgatgt |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
52432356 |
atgctcttgtggtgcatttggaataacaacaggcaacccccaaatcaggttggtaagcaaaattttaacttatgggaacctggcatgcttggttcgatgt |
52432257 |
T |
|
| Q |
310 |
tcataatatccagcagagtagtagtaataatgctcattgtcttcct |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52432256 |
tcataatatccagcagagtagtagtaataatgctcattgtcttcct |
52432211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University