View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18855_low_11 (Length: 313)
Name: NF18855_low_11
Description: NF18855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18855_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 11 - 172
Target Start/End: Complemental strand, 4683018 - 4682857
Alignment:
| Q |
11 |
ttatacttcaaatttatttgtcactgtgctggaattttacacactgtaaatacttgatgccattttagtcacatgatatttaaactccattagatttctt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4683018 |
ttatacttcaaatttatttgtcactgtgctggaattttacacactgtaaatacttgatgccattttagtcacatgatatttaaactccattagatttctt |
4682919 |
T |
 |
| Q |
111 |
tagactagaagtcttgcttataagatatatggactatctttatgattctgtggattctcctt |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4682918 |
tagactagaagtcttgcttataagatatatggactatctttatgattctgtggattttcctt |
4682857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 159 - 278
Target Start/End: Complemental strand, 4682640 - 4682519
Alignment:
| Q |
159 |
tgtggattctccttttctaaccagatttcttccatgcaagagtgagtgatcaaatctctttccacttgtttaaagtgtttactctcatgttacccagatc |
258 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4682640 |
tgtgaattctcctcttctaaccagatttcttccatgcaagagtgagtgatcaaatctctttccacttgtttaaagtgtttactctcatgttacccagatc |
4682541 |
T |
 |
| Q |
259 |
aatcatat--tggtatgttggt |
278 |
Q |
| |
|
|||||||| |||||||||||| |
|
|
| T |
4682540 |
aatcatattgtggtatgttggt |
4682519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University