View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18856_high_26 (Length: 279)
Name: NF18856_high_26
Description: NF18856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18856_high_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 23 - 273
Target Start/End: Original strand, 43097398 - 43097648
Alignment:
| Q |
23 |
gatcacacgataggtgtcaagtaattcctttttatcctccaaatacgagttggatgaagcttaactacgatggcgaaattacaaaatctgactatgcatg |
122 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43097398 |
gatcacacgataggtgtgaagtaattcttttttatcctccaaatacgagttggatgaagcttaactacgatggcgaaattacaacatctgactatgcatg |
43097497 |
T |
|
| Q |
123 |
catcttgttgtgtcgtgcttaggaaacatcttagaacaatgtttggtgtcatgtgttgctgctaagctggagatttgtaccatcacacatacagagttgt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43097498 |
catcttgttgtgtcgtgcttaggaaacatctcagaacaatgtttggtgtcatgtgttgctgctaagctggagatttgtaccatcacacatacagagttgt |
43097597 |
T |
|
| Q |
223 |
ggggtattttactcagtcttaagctcagtattgctactaactttcttttca |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43097598 |
ggggtattttactcagtcttaagctcagtattgctactaactttcttttca |
43097648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University