View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18856_high_33 (Length: 249)
Name: NF18856_high_33
Description: NF18856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18856_high_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 6 - 230
Target Start/End: Original strand, 1315609 - 1315833
Alignment:
| Q |
6 |
caagaaagtttggtagtagaatggtgttggaaaatgaagttggtcaagtatcttgagttgttgtgtggggatagtgcaagtgagtaatgtaaatccaaag |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1315609 |
caagaaagtttggtagtagaatggtgttggaaaatgaagttggtcaagtatcttgagttgttgtgtgggaatagtgcaagtgagtaatgtaaatccaaag |
1315708 |
T |
 |
| Q |
106 |
aatcctcttgggtgtgatgtaggtgaataatgtggctcaaatttaggaagacttgttgcgaggcaggtacgatatgatgcatatactcaagtcagccaga |
205 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1315709 |
aatcctcttgggtgtgatataggtgaataatgtggctcaagtttaggaagacttgttgcgaggcaggtacgatatgatgcataaactcaagtcagccaga |
1315808 |
T |
 |
| Q |
206 |
gaagttgtgttgttttggtgcaaac |
230 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
1315809 |
gaagttgtgttgttttggtgcaaac |
1315833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University