View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18856_high_36 (Length: 234)
Name: NF18856_high_36
Description: NF18856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18856_high_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 42796320 - 42796540
Alignment:
| Q |
1 |
cattaacccagcagtgacatttgggctatttttggctcgtaaggtgtctttgatcagagcaattatgtacatggtggctcagtgtttaggagctattgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42796320 |
cattaacccagcagtgacatttgggctatttttggctcgtaaggtgtctttgatcagagcaattatgtacatggtggctcagtgtttaggagctattgct |
42796419 |
T |
 |
| Q |
101 |
ggagttgggttggttaaggcttttcaaagtgcttactttgatagatatggtggtggtgctaattttctccatgatggttacagtaccggtgttggattag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42796420 |
ggagttgggttggttaaggcttttcaaagtgcttactttgatagatatggtggtggtgctaattttctccatgatggttacagtactggtgttggattag |
42796519 |
T |
 |
| Q |
201 |
gtgctgagattgttggtacct |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42796520 |
gtgctgagattgttggtacct |
42796540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 14 - 126
Target Start/End: Complemental strand, 40835400 - 40835288
Alignment:
| Q |
14 |
gtgacatttgggctatttttggctcgtaaggtgtctttgatcagagcaattatgtacatggtggctcagtgtttaggagctattgctggagttgggttgg |
113 |
Q |
| |
|
|||||||||||||||||| |||| | |||||||| ||||| ||||| | | |||||||| ||||||||||||||||| || ||| ||||| ||| |
|
|
| T |
40835400 |
gtgacatttgggctatttctggcgaggaaggtgtcattgattagagctgtattatacatggtagctcagtgtttaggagcaatatgtggtgttggactgg |
40835301 |
T |
 |
| Q |
114 |
ttaaggcttttca |
126 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40835300 |
ttaaggcttttca |
40835288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University