View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18856_low_38 (Length: 235)
Name: NF18856_low_38
Description: NF18856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18856_low_38 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 5 - 215
Target Start/End: Original strand, 3299828 - 3300038
Alignment:
| Q |
5 |
gaaacttaataataatctctctcctagaatcactaaaaaagaaggtgagagggaatgattttagttaagaaaaaaccggagaagatatatcatatcatag |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3299828 |
gaaacttaataataatctctctcctagaatcactaaaaaagaaggtgagagggaatgattttagttaagaaaaaaccggagaagatatatcatatcatag |
3299927 |
T |
|
| Q |
105 |
cataagcatagcataggtttaggtatcattattattatactataaaattcgttatacggtcacaacaacattctgaattcaattctgattctgatagtga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3299928 |
cataagcatagcataggtttaggtatcattattattatactataaaattcgttatacggtcacaacaacattctgaattcaattctgattctgatagtga |
3300027 |
T |
|
| Q |
205 |
tacaacgacct |
215 |
Q |
| |
|
||||||||||| |
|
|
| T |
3300028 |
tacaacgacct |
3300038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University