View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18856_low_40 (Length: 232)
Name: NF18856_low_40
Description: NF18856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18856_low_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 50 - 211
Target Start/End: Original strand, 17913944 - 17914098
Alignment:
| Q |
50 |
aaactttgaaaaccctaatcatatatataccttccttattcgcgcttctctcttactctcttcttcatagcaaattctcccttctcctagttaatccctc |
149 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
17913944 |
aaactttgaaaaccctaatcatata----ccttccttgttcgcgcttctctcttactctcgtc---atagcaaattctcccttctcctagttaatccctc |
17914036 |
T |
 |
| Q |
150 |
cgccatgtctcctcagcaacctatctgtgttgatccaaaaatctggcagtgctgcgccggcg |
211 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17914037 |
cgccatgtctcctcagcaacctatccgtgttgatccaaaaatctggcagtgctgcgccggcg |
17914098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University