View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18856_low_41 (Length: 217)

Name: NF18856_low_41
Description: NF18856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18856_low_41
NF18856_low_41
[»] chr2 (1 HSPs)
chr2 (20-205)||(2017059-2017244)
[»] chr3 (3 HSPs)
chr3 (18-176)||(40566428-40566586)
chr3 (18-168)||(40595808-40595958)
chr3 (18-176)||(40589404-40589562)


Alignment Details
Target: chr2 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 20 - 205
Target Start/End: Complemental strand, 2017244 - 2017059
Alignment:
20 gttggctgtgacacgattgcaatactcgcagcatttgattttgggggaaacaactacacgacgggatgtttggctttgtgcaacaggtttaatgatatcg 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
2017244 gttggctgtgacacgattgcaatactcgcagcatttgattttgggggaaacaactacaccacgggatgtttggctttgtgcaacaggtttaatgatatcg 2017145  T
120 tggccaatgaatcttgctccggcactggttgttgtcagatttcaataccgcaaggtcatttgttcgagaaagtgtcctttgctact 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
2017144 tggccaatgaatcttgctccggcactggttgttgtcagatttcaataccgcaaggtcatttgttcgagaaagtgtcctttgttact 2017059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 67; Significance: 6e-30; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 18 - 176
Target Start/End: Original strand, 40566428 - 40566586
Alignment:
18 cagttggctgtgacacgattgcaatactcgcagcatttgattttgggggaaacaactacacgacgggatgtttggctttgtgcaacaggtttaatgatat 117  Q
    ||||||||||||||||||||| |  |||| | ||  |||||| |||||||||||||||||| || |||||| ||||||| ||||||||| || |||||||    
40566428 cagttggctgtgacacgattggagcactctcggcgattgattctgggggaaacaactacaccacaggatgtgtggctttatgcaacaggcttgatgatat 40566527  T
118 cgtggccaatgaatcttgctccggcactggttgttgtcagatttcaataccgcaaggtc 176  Q
      |||||| | |||||||||| || |||||||||||  ||||||||||||| |||||||    
40566528 tatggccagtcaatcttgctcaggtactggttgttgcgagatttcaataccccaaggtc 40566586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 18 - 168
Target Start/End: Original strand, 40595808 - 40595958
Alignment:
18 cagttggctgtgacacgattgcaatactcgcagcatttgattttgggggaaacaactacacgacgggatgtttggctttgtgcaacaggtttaatgatat 117  Q
    ||||||| |||||||| || | | |||||| |||| |||||| |   |||||||  ||||| || | |||| |||| |||||||||||| ||| ||||||    
40595808 cagttggatgtgacacaatgggactactcgaagcaattgattctaaaggaaacacatacaccactgcatgtgtggccttgtgcaacaggcttagtgatat 40595907  T
118 cgtggccaatgaatcttgctccggcactggttgttgtcagatttcaatacc 168  Q
     ||||||||||||||||| |||||| | ||||||||| |||||||||||||    
40595908 tgtggccaatgaatcttgttccggcccaggttgttgtgagatttcaatacc 40595958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 18 - 176
Target Start/End: Original strand, 40589404 - 40589562
Alignment:
18 cagttggctgtgacacgattgcaatactcgcagcatttgattttgggggaaacaactacacgacgggatgtttggctttgtgcaacaggtttaatgatat 117  Q
    ||||||||||||| ||   || |||||||| || | |||||| ||  ||||||||||||||  | ||||||||||||| ||||||||||     |||| |    
40589404 cagttggctgtgatacatctggaatactcggagtaattgattctgaaggaaacaactacacctctggatgtttggcttggtgcaacaggcacgctgatct 40589503  T
118 cgtggccaatgaatcttgctccggcactggttgttgtcagatttcaataccgcaaggtc 176  Q
    ||| |||||||| ||||| || ||  |||||||||| ||||||||  |||| |||||||    
40589504 cgttgccaatgagtcttgttctggtcctggttgttgccagatttcggtaccccaaggtc 40589562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University