View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18856_low_42 (Length: 217)
Name: NF18856_low_42
Description: NF18856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18856_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 42796259 - 42796063
Alignment:
| Q |
1 |
ttcaaataatagtaaccccttataaaataaacnnnnnnnctctttcaagttaa-catttttttctcattcatcatatttgcaagaacnnnnnnnnnnnnn |
99 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42796259 |
ttcaaataatagtaaccctttataaaataaacaaaaaaactctttcaagttaaacatttttttctcattcatcatatttgcaagaacaaaaaaaaaaaa- |
42796161 |
T |
 |
| Q |
100 |
nnngtccgtaagccctaactcaactgacaataccgatattgttaggtcggacacttttataccaatattgtgagttttcagtgatacgaaggactcaaaa |
199 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
42796160 |
---gcccgtaagccctaactcaactgacaataccgatattgttaggtcggacacttttataccaatattgtgag-tttcagtgatactaaggactcaaaa |
42796065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 103 - 146
Target Start/End: Original strand, 41452785 - 41452828
Alignment:
| Q |
103 |
gtccgtaagccctaactcaactgacaataccgatattgttaggt |
146 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||| |||||||||| |
|
|
| T |
41452785 |
gtccgtaagacctaactcaactgacaatagcgagattgttaggt |
41452828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 103 - 156
Target Start/End: Complemental strand, 9559180 - 9559127
Alignment:
| Q |
103 |
gtccgtaagccctaactcaactgacaataccgatattgttaggtcggacacttt |
156 |
Q |
| |
|
||||||||| |||| ||||| ||||||||| ||||||||||||| | ||||||| |
|
|
| T |
9559180 |
gtccgtaaggcctagctcaattgacaatactgatattgttaggttgaacacttt |
9559127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University