View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18857_low_21 (Length: 249)
Name: NF18857_low_21
Description: NF18857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18857_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 230
Target Start/End: Original strand, 31028355 - 31028572
Alignment:
| Q |
13 |
aagaatataatcgttgcttaatgttaaccgttacttaatatgactgaaaattttcttttacgtgacagctccatataaaaatgctactacttttcaagaa |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31028355 |
aagaaaataatcgttgcttaatgttaaccgttacttaatatgactgaaaattttcttttacgtgacagctccatataaaaatgctactacttttcaagaa |
31028454 |
T |
 |
| Q |
113 |
ttgtattaggtcaaatttggggtgttgagtttttcattt-aaaaaattattttgtagatatctttaatataaaatttgaaattgatagaaataatgaaat |
211 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||| |||||||||||| |
|
|
| T |
31028455 |
ttgaattaggtcaaatttggggtgttgagtttttcatttaaaaaaattattttgtagatatctttaatacaaaatttgaaactgata-aaataatgaaat |
31028553 |
T |
 |
| Q |
212 |
ttggaaaggtacagatttg |
230 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
31028554 |
ttggaaaggtacagatttg |
31028572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University