View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18857_low_23 (Length: 239)
Name: NF18857_low_23
Description: NF18857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18857_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 15 - 221
Target Start/End: Original strand, 44974766 - 44974972
Alignment:
| Q |
15 |
aatattggaagaactaaaggtaaaagcagagagatcagatacaagagttcaaggattcatgaaatttgtacactttttagaaggttttggaagatcatat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44974766 |
aatattggaagaactaaaggtaaaagcagagagatcagatacaagagttcaaggattcatgaaatttgtacactttttagaagattttggaagatcatat |
44974865 |
T |
 |
| Q |
115 |
accgaacaaaacaactactgttgacaaacacagcagaagcattacttgttggtcttgttttaggaacaatttacataaacattgggtttgataaagaagg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44974866 |
accgaacaaaacaactactgttgacaaacacagcagaagcattacttgttggtcttgttttaggaacaatttacataaacattgggtttgataaagaagg |
44974965 |
T |
 |
| Q |
215 |
gattgag |
221 |
Q |
| |
|
||||||| |
|
|
| T |
44974966 |
gattgag |
44974972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University