View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18857_low_24 (Length: 210)
Name: NF18857_low_24
Description: NF18857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18857_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 7 - 131
Target Start/End: Complemental strand, 34451877 - 34451753
Alignment:
| Q |
7 |
ggacatcatcatgtctgaagatcttcccctcatttgatgacttatcagtgaaattaggtgaccgatatgtataaattggaatgtggagttgattacctaa |
106 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34451877 |
ggacatgatcatgtctgaagatcttcccgtcacttgatgacttatcaatgaaattaggtgaccgatatgtataaattggaatgtggggttgattacctaa |
34451778 |
T |
|
| Q |
107 |
tatgatcatatttatattagaaata |
131 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
34451777 |
tatgatcatatttatattagaaata |
34451753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University