View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18858_high_20 (Length: 239)
Name: NF18858_high_20
Description: NF18858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18858_high_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 1e-52; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 80 - 223
Target Start/End: Original strand, 39135764 - 39135907
Alignment:
| Q |
80 |
atgtcctggaaatttttcaaagatttcaaagctgaaggttgaaagnnnnnnnnnnnnncttcccaggatgttgaggtgttcttgtaattgctgagaggtt |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39135764 |
atgtcctggaaatttttcaaagatttcaaagctgaaggttgaaagtttttatttttttcttcccaggatgttgaggtgttcttgtaattgctgagaggtt |
39135863 |
T |
|
| Q |
180 |
atagtttctatagttgaatgatggatattgttgaggctactcat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39135864 |
atagtttctatagttgaatgatggatattgttgaggctactcat |
39135907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 138 - 217
Target Start/End: Complemental strand, 39877818 - 39877738
Alignment:
| Q |
138 |
cttcccaggatgttgaggtgttcttgtaattgctgagaggttatagttt-ctatagttgaatgatggatattgttgaggct |
217 |
Q |
| |
|
||||||||||| |||||| ||| |||||| |||||||| ||| ||||| |||||||||||| |||||| |||| |||||| |
|
|
| T |
39877818 |
cttcccaggattttgaggggtttgtgtaatagctgagagtttaaagttttctatagttgaatcatggatgttgtcgaggct |
39877738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 217
Target Start/End: Complemental strand, 39423062 - 39422983
Alignment:
| Q |
139 |
ttcccaggatgttgaggtgttcttgtaattgctgagaggttatagttt-ctatagttgaatgatggatattgttgaggct |
217 |
Q |
| |
|
|||||||||| |||||||||| ||| || |||||||| ||| ||||| |||||||| ||| |||||| ||||||||||| |
|
|
| T |
39423062 |
ttcccaggattttgaggtgtttgtgttatagctgagagtttaaagttttctatagttcaatcatggatgttgttgaggct |
39422983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 172 - 217
Target Start/End: Complemental strand, 39416875 - 39416830
Alignment:
| Q |
172 |
gagaggttatagtttctatagttgaatgatggatattgttgaggct |
217 |
Q |
| |
|
||||| ||| ||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
39416875 |
gagagtttacagtttctatagttcaatgatggatgttgttgaggct |
39416830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 140 - 173
Target Start/End: Complemental strand, 39488589 - 39488556
Alignment:
| Q |
140 |
tcccaggatgttgaggtgttcttgtaattgctga |
173 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
39488589 |
tcccaggattttgaggtgttcttgtaattgctga |
39488556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 138 - 199
Target Start/End: Original strand, 19806205 - 19806266
Alignment:
| Q |
138 |
cttcccaggatgttgaggtgttcttgtaattgctgagaggttatagtttctatagttgaatg |
199 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
19806205 |
cttcccaggattttgaggtgttcttgtaattgctgagaagttacagtttctatagttgaatg |
19806266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University