View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18858_low_14 (Length: 314)
Name: NF18858_low_14
Description: NF18858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18858_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 117 - 198
Target Start/End: Original strand, 32868886 - 32868967
Alignment:
| Q |
117 |
agatttgcgagtttcaaattttagcaaagcttgtttatctgatgctgattttgtgttgtgattgtgaccattaccgcaacaa |
198 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32868886 |
agatttgcgagtttcaaattatagcaaaccttgtttatctgatgcttattttgtgttgtgattgtgaccattaccgcaacaa |
32868967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University