View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18858_low_24 (Length: 239)
Name: NF18858_low_24
Description: NF18858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18858_low_24 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 10 - 239
Target Start/End: Complemental strand, 19074773 - 19074545
Alignment:
| Q |
10 |
acatcatcatcgattgcaaatggcagaccatggcagaagccaataaaccgccattaaacgccatagtgtcatccttcacaaatttaccatgtcaattgtc |
109 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
19074773 |
acattatcatcgattgcaaatggcagcccatggcagaagccaataaaccgccattaaacgccataatgtcatccttcacaaatttaccatgtcagttgtc |
19074674 |
T |
 |
| Q |
110 |
nnnnnnntctaccagcgcaatccaccgtgtgcgatatttgacaaatattgacttcctatgtacagccacgtggcgttatactttcaccccgggcannnnn |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
19074673 |
aaaaaaatctaccagcgcaatccaccgtgtgcgatatttgacaaatattgacttcctatgtacagccacgtggcgttacactttcaccccggaca-tttt |
19074575 |
T |
 |
| Q |
210 |
nnncgcaacagaaagtacacaattttacac |
239 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
19074574 |
tttcgcaacagaaagtacacaattttacac |
19074545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University