View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18858_low_25 (Length: 234)
Name: NF18858_low_25
Description: NF18858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18858_low_25 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 53 - 234
Target Start/End: Original strand, 19074237 - 19074418
Alignment:
| Q |
53 |
gtgttataatttggaattcttattcatttggtgttgtgtgaatcttgcagcacgcatcttttggttcaagaagatgtggataaggtgaatccagttgata |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19074237 |
gtgttataatttggaattcttattcatttggtgttgtgtgaatcttgcagcacgcatcttttggttcaagaagatgtggataaggtgaatccagttgata |
19074336 |
T |
 |
| Q |
153 |
aagaaaagggtgtcacacttgaggattttaagctcattaagatgcatatgtccaattgtatgtatgctcactttttatatat |
234 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19074337 |
aagaaaagggtgtcacccttgaggattttaagctcattaagatgcatatgtccaattgtatgtatgctcactttttatatat |
19074418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University