View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18859_high_10 (Length: 219)
Name: NF18859_high_10
Description: NF18859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18859_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 23 - 199
Target Start/End: Complemental strand, 50199105 - 50198931
Alignment:
| Q |
23 |
tagaggagacgtgtggtgtgtctatgtaaggctaatgaaaatcaataaattcggcactaaattgtcatgaaatttatgtatagttcaattggaaaattat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50199105 |
tagaggagacgtgtggtgtgtctatgtaaggctaatgaaa-tcaataaattcggcactaaattgtcatgaaatttatgtatagttcaattggaaa-ttat |
50199008 |
T |
|
| Q |
123 |
gaaacttatgttccaaaagacattttgaattttgagttcattcaaaagagtgtactaattaatatgatattttgaat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50199007 |
gaaacttatgttccaaaagacattttgaattttgagttcattcaaaagagtgtactaattaatatgatattttgaat |
50198931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University