View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18859_low_7 (Length: 289)
Name: NF18859_low_7
Description: NF18859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18859_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 1423353 - 1423554
Alignment:
| Q |
1 |
tgtatcttagccttttaattgcttcagatcttcacctaaattttcttttaacactcttgcaaatgaaaaagagnnnnnnnnnngttaatccaagagagag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
1423353 |
tgtatcttagccttttaattgcttcagatcttcacctaaattttcttttaacactcttgcaaatgaaagagagaaaaaaaaa--ttaatccaagagagag |
1423450 |
T |
 |
| Q |
101 |
aataataatttttgagatataaagagtgcaaaaattgcatggcttaagagagaggagaccaaatgcataaggtactgcatgcaactctctgactgttttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1423451 |
aataataatttttgagatataaagagtgcaaaaattgcatggctt-agagagagaagaccaaatgcataagttactgcatgcaactctctgactgttttt |
1423549 |
T |
 |
| Q |
201 |
tagta |
205 |
Q |
| |
|
||||| |
|
|
| T |
1423550 |
tagta |
1423554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 93 - 205
Target Start/End: Original strand, 1416702 - 1416809
Alignment:
| Q |
93 |
agagagagaataataatttttgagatataaagagtgcaaaaattgcatggcttaagagagaggagaccaaatgcataaggta---ctgcatgcaactctc |
189 |
Q |
| |
|
||||||||| ||||||||||||||| |||| |||||||||||||| ||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1416702 |
agagagagagtaataatttttgagagataa-gagtgcaaaaattggatg-------agagaggagaccaaatgcataaggtacttctgcatgcaactctc |
1416793 |
T |
 |
| Q |
190 |
tgactgttttttagta |
205 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
1416794 |
tgattgttttttagta |
1416809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University