View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18862_low_3 (Length: 250)
Name: NF18862_low_3
Description: NF18862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18862_low_3 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 16 - 250
Target Start/End: Complemental strand, 37837456 - 37837221
Alignment:
| Q |
16 |
ctgttgaaagtttacatttcttctgttaagagcatctatcttcaatgaaggtgtcaaagaggatttatatgttgatcaacggcgctgctatacatagcta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| | |
|
|
| T |
37837456 |
ctgttgaaagtttacatttcttctgttaagagcatctatcttcaatgaaggtgtcaaagaggatttatatgttgatgaacggtgctgctatacatagcga |
37837357 |
T |
|
| Q |
116 |
gaaaaatcatcccgaaattcacgaaggctacgtgtcaatattcaaagttgtggggaaaatgcatgaggcagcttacaataggaaa-tgggcggaaaacat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37837356 |
gaaaaatcatcccgaaattcacgaaggctacgtgtcaatattcaaagttgtggggaaaatgcatgaggcagcttacaataggaaattgggcggaaaacat |
37837257 |
T |
|
| Q |
215 |
tggtgcttgaccaatagaaatgatttctggacaatt |
250 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37837256 |
tggtgcttgaccaatagaaatgatttcgggacaatt |
37837221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University