View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18863_low_15 (Length: 238)
Name: NF18863_low_15
Description: NF18863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18863_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 143 - 224
Target Start/End: Original strand, 1191022 - 1191103
Alignment:
| Q |
143 |
taccataatttaaaaggaaggtacaagatctaagttgctatacagctccttaccaaataataatgaagaatctagtaattct |
224 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1191022 |
taccagaatttaaaaggaaggtacaagatctaagttgctatacagctccttaccaaataataatgaagaatctagtaattct |
1191103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 42 - 96
Target Start/End: Original strand, 6692320 - 6692374
Alignment:
| Q |
42 |
attctataaaattcataaaagccgcatatataaatgtgtgtgtcggtgtatgtgt |
96 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||| || ||| |||||| |
|
|
| T |
6692320 |
attctgtaaaattcataaaagccgcatacataaatgtgtgtatcagtgcatgtgt |
6692374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 149 - 224
Target Start/End: Complemental strand, 24222440 - 24222365
Alignment:
| Q |
149 |
aatttaaaaggaaggtacaagatctaagttgctatacagctccttaccaaataataatgaagaatctagtaattct |
224 |
Q |
| |
|
|||||||||||| | ||||||| | | ||||||| | |||| ||||| |||||| || |||||||||||||||||| |
|
|
| T |
24222440 |
aatttaaaaggatgttacaagacccaggttgctagatagctacttacaaaataagaacgaagaatctagtaattct |
24222365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University