View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18863_low_16 (Length: 234)
Name: NF18863_low_16
Description: NF18863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18863_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 54847906 - 54847660
Alignment:
| Q |
1 |
tatatatgggaagctggtgaatcaactaaatataaaattatggtatgagaggcacattccgttacttaagaaaatgattggattggattggatttagatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54847906 |
tatatatgggaagctggtgaatcaactaaatataaaattatggtatgagaggcacatt-cgttacttaagaaaatgattggattggattggatttagatt |
54847808 |
T |
|
| Q |
101 |
caataattaaatat----------------ggtaaaagagttgtatgttatcaccgcatccttgtctacacttactctcaatcattcaagagactactaa |
184 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
54847807 |
caataattaaatatgggaatggtgtttataggtaaaagagttgtatgttatcaccgcatccttgtctacactttctctcaatcattcaagagactactaa |
54847708 |
T |
|
| Q |
185 |
tttcagatg---aataaaaatatatgcaatgagcctccctttgcttct |
229 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
54847707 |
tttcagatgaataataaaaatatatgcaatgagcctccctttgtttct |
54847660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University