View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18863_low_17 (Length: 217)

Name: NF18863_low_17
Description: NF18863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18863_low_17
NF18863_low_17
[»] chr6 (1 HSPs)
chr6 (23-190)||(27960637-27960804)
[»] chr4 (1 HSPs)
chr4 (81-197)||(2522327-2522443)


Alignment Details
Target: chr6 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 23 - 190
Target Start/End: Complemental strand, 27960804 - 27960637
Alignment:
23 taattactaatcaaaaccatattgaattgaatcaagattccgataacataacaactattcaaatctgggttacagagcaaaacttatgactaaaatacca 122  Q
    ||||||||||||||||||||||| |||||||||||||||||||||| |||||||  |||||||||| |||||||||||||||||||||||| ||||||||    
27960804 taattactaatcaaaaccatattaaattgaatcaagattccgataatataacaagcattcaaatctaggttacagagcaaaacttatgactcaaatacca 27960705  T
123 catgtatacccatacgaatttctactcaaatgtcataaagcttaagtataatcacttttaacaataat 190  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
27960704 catgtatacccatacgaatttctactcaaatgtcataaagctcaagtataatcacttttaacaataat 27960637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 81 - 197
Target Start/End: Complemental strand, 2522443 - 2522327
Alignment:
81 tcaaatctgggttacagagcaaaacttatgactaaaataccacatgtatacccatacgaatttctactcaaatgtcataaagcttaagtataatcacttt 180  Q
    ||||| || ||||| |||||||||||||||||| |||||||||||||| |||| |||||| |||||||||||| |||||||| | ||||| |||||||||    
2522443 tcaaaacttggttatagagcaaaacttatgactcaaataccacatgtacacccgtacgaaattctactcaaatttcataaagttcaagtacaatcacttt 2522344  T
181 taacaataataatccat 197  Q
    ||||| |||||||||||    
2522343 taacagtaataatccat 2522327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University