View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18864_high_19 (Length: 237)
Name: NF18864_high_19
Description: NF18864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18864_high_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 35868301 - 35868081
Alignment:
| Q |
1 |
gctcatttcaggtggtttttgtgtcatatgcatgttagaaaacttagcacagatcaatattcaatctataatcgcagccatgacatatttaagtaaccta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35868301 |
gctcatttcaggtggtttttgtgtcatatgcatgttagaaaacttagcacagatcaatattcaatctataatcgcagccatgacatatttaagtaaccta |
35868202 |
T |
|
| Q |
101 |
tgtatgctgtagattaatcttttgaattgccatgaaataggaagcatggaatcctcttcaagttgtcactagcaaatttcatagtgtttaggagggcaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35868201 |
tgtatgctgtagattaatcttttgaattgccatgaaataggaagcatggaatcctcttcaagttgtcactagcaaatttcatagtgtttaggagggcaag |
35868102 |
T |
|
| Q |
201 |
gagttgacgatctccattatc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
35868101 |
gagttgacgatctccattatc |
35868081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University