View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18864_low_23 (Length: 211)
Name: NF18864_low_23
Description: NF18864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18864_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 30 - 170
Target Start/End: Complemental strand, 43341069 - 43340929
Alignment:
| Q |
30 |
ccatctttttgttgttgtctgtgcagtgataaacactcccaatactacnnnnnnncttctttccctcatttccaccaaatttccttccactaacccaaca |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43341069 |
ccatctttttgttgttgtctgtgcagtgataaacactcccaatactactttttttcttctttcccttatttccaccaaatttccttccactaacccaaca |
43340970 |
T |
 |
| Q |
130 |
gataaacaataccaaactccaacatatactctcatttcatt |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43340969 |
gataaacaataccaaactccaacatatactctcatttcatt |
43340929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University