View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18864_low_24 (Length: 204)

Name: NF18864_low_24
Description: NF18864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18864_low_24
NF18864_low_24
[»] chr8 (1 HSPs)
chr8 (10-188)||(41094203-41094381)


Alignment Details
Target: chr8 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 10 - 188
Target Start/End: Complemental strand, 41094381 - 41094203
Alignment:
10 catcatcagtttcattggtttgaaacggagtaacgaaatcagggttagggttagggcttgaaactccgaatccatatccgggaggagaatgttggtcatt 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41094381 catcatcagtttcattggtttgaaacggagtaacgaaatcagggttagggttagggcttgaaactccgaatccatatccgggaggagaatgttggtcatt 41094282  T
110 gttgatgttgttgctggtgtcaacggtgaggtgatcgtcgtcgggattatttggaggatggaatgtggatccataatca 188  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41094281 gttgatgttgttgctggtgtcaacggtgaggtgatcgtcgtcgggattatttggaggatggaatgtggatccataatca 41094203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University