View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18864_low_24 (Length: 204)
Name: NF18864_low_24
Description: NF18864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18864_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 10 - 188
Target Start/End: Complemental strand, 41094381 - 41094203
Alignment:
| Q |
10 |
catcatcagtttcattggtttgaaacggagtaacgaaatcagggttagggttagggcttgaaactccgaatccatatccgggaggagaatgttggtcatt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41094381 |
catcatcagtttcattggtttgaaacggagtaacgaaatcagggttagggttagggcttgaaactccgaatccatatccgggaggagaatgttggtcatt |
41094282 |
T |
 |
| Q |
110 |
gttgatgttgttgctggtgtcaacggtgaggtgatcgtcgtcgggattatttggaggatggaatgtggatccataatca |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41094281 |
gttgatgttgttgctggtgtcaacggtgaggtgatcgtcgtcgggattatttggaggatggaatgtggatccataatca |
41094203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University