View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18864_low_5 (Length: 436)
Name: NF18864_low_5
Description: NF18864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18864_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 3e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 153 - 364
Target Start/End: Complemental strand, 54724481 - 54724270
Alignment:
| Q |
153 |
cttcatgtgtctgctttatttattttactattgtttagcatgatatgatgaatctaaaatgtcttgtacgttgtcaaaaggttaggaatatgatgatgtt |
252 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
54724481 |
cttcatgtgtctattttatttattttactaatgtttagcatgatatgatgaatctaaaatgtcttgtacgttgtcaaaaagttaggaatatgatgatgtt |
54724382 |
T |
|
| Q |
253 |
gttccaaatatattgaatttcaaatcaatgaaatgaacnnnnnnntgtaacaactttcccttctatcgtatcatcattgtcaagcacatcgtgttaggca |
352 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
54724381 |
gttccaaataaattgaatttcaaatcaatgaaatgaacaaaaaaatgtaacaactttcccttctatcgtatcatcattgttaagcacatcgtgttaggca |
54724282 |
T |
|
| Q |
353 |
caacgagcaaaa |
364 |
Q |
| |
|
|||||||||||| |
|
|
| T |
54724281 |
caacgagcaaaa |
54724270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 357 - 427
Target Start/End: Complemental strand, 54724249 - 54724179
Alignment:
| Q |
357 |
gagcaaaacattatgcgtcaacatgtgttttgataatatcgtgtattctgtaatataacttgatatatttt |
427 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
54724249 |
gagcaaaacattatgcgtcaacatatgtttttatattatcgtgtattctgtaatataacttgatatatttt |
54724179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University