View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18865_high_12 (Length: 304)
Name: NF18865_high_12
Description: NF18865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18865_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 16 - 287
Target Start/End: Complemental strand, 45635385 - 45635108
Alignment:
| Q |
16 |
atatatttaatttctttacgcattctcagttgacattacannnnnnnatagttcctattaaagtatgtccaacgtgatatttaaagaatagatggaaaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45635385 |
atatatttaatttctttacgcattctcagttgacattacatttttttatagttcctattaaagtatgtccaacgtgatatttaaagaatagatggaaaaa |
45635286 |
T |
 |
| Q |
116 |
tgg---------ttgcttgcaataatataaaa-gcaaactcgtattacaatctcatggtttccttagtagtctgttttgtttcccttcattgatcccctc |
205 |
Q |
| |
|
||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45635285 |
tgggggttaaccttgcttgcaataatataaaaagcaaactcgtattacaatctcatggtttccttagtagtctgttttgtttcccttcattgatcccctc |
45635186 |
T |
 |
| Q |
206 |
gctatctcatcgatcaaatggcattctctaatattgctatggttttgtgcttctttttagcaatcataatggcactgccaac |
287 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45635185 |
gctatctc----atcaaatggcattctctaatattgctatggttttgtgcttctttttagcaatcaacatggcactgccaac |
45635108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University