View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18865_high_20 (Length: 226)
Name: NF18865_high_20
Description: NF18865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18865_high_20 |
 | |
|
| [»] scaffold1889 (1 HSPs) |
| | |
|
| [»] scaffold1723 (1 HSPs) |
| | |
|
| [»] scaffold1515 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold1889 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: scaffold1889
Description:
Target: scaffold1889; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 18 - 162
Target Start/End: Original strand, 879 - 1023
Alignment:
| Q |
18 |
aaaggaaggtgaatgaggcccagctttatgaacctctcaatcagattggccacgttatttccgttagggtttgtcgggatcagatgacgcagtcatctct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
879 |
aaaggaaggtgaatgaggcccagctttatgaacctctctatcagattggccacgttatttccgtcagggtttgtagggatcagatgacgcagtcatctct |
978 |
T |
|
| Q |
118 |
tggttatggctatgtcaactactccaacgctcgtgatggttcgtg |
162 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
979 |
tggttatggctatgtcaacttctccaacgctcgtgatggttcgtg |
1023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 74 - 158
Target Start/End: Complemental strand, 14408580 - 14408496
Alignment:
| Q |
74 |
atttccgttagggtttgtcgggatcagatgacgcagtcatctcttggttatggctatgtcaactactccaacgctcgtgatggtt |
158 |
Q |
| |
|
||||| ||||||||||| | |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14408580 |
atttctgttagggtttgcagagatcagatgacgcagtcatctcttggttatggctatgttaactactccaacgctcgtgatggtt |
14408496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1723 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold1723
Description:
Target: scaffold1723; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 21 - 162
Target Start/End: Complemental strand, 1089 - 948
Alignment:
| Q |
21 |
ggaaggtgaatgaggcccagctttatgaacctctcaatcagattggccacgttatttccgttagggtttgtcgggatcagatgacgcagtcatctcttgg |
120 |
Q |
| |
|
|||| ||||| ||||| |||||||||||| |||||||||| || || ||| |||| | ||||||||| ||||||||| || || || |||||||| |
|
|
| T |
1089 |
ggaacgtgaacgaggcacagctttatgaattgttcaatcagataggtcaggttgtttcaatcagggtttgtagggatcagacgatgcggttgtctcttgg |
990 |
T |
|
| Q |
121 |
ttatggctatgtcaactactccaacgctcgtgatggttcgtg |
162 |
Q |
| |
|
|||| |||||||| | |||||| ||||||||||||||||| |
|
|
| T |
989 |
ctatgcttatgtcaatttctccaatgctcgtgatggttcgtg |
948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1515 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold1515
Description:
Target: scaffold1515; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 82 - 118
Target Start/End: Complemental strand, 37 - 1
Alignment:
| Q |
82 |
tagggtttgtcgggatcagatgacgcagtcatctctt |
118 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37 |
tagggtttgccgggatcagatgacgcagtcatctctt |
1 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University