View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18865_low_20 (Length: 253)
Name: NF18865_low_20
Description: NF18865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18865_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 28966286 - 28966050
Alignment:
| Q |
1 |
tgctaatagtatgtgacaattggagcttgaaaaattgtactaaaaattaaaataaaggatagttacttggttatagaaaactggtacgaagtttcgttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28966286 |
tgctaatagtatgtgacaattggagcttgaaaaattgtactaaaaattaaaataaaggatagttacttggttatagaaaactggtacgaagtttcgttca |
28966187 |
T |
|
| Q |
101 |
aaagtccattctggttaggagagctgtattattatacccctttttaggctttagctagctttacattgaaacctatgagacagttctggattcgaatact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28966186 |
aaagtccattctggttaggagagctgtattattatacccctttttaggctttagctagctttacattgaaacctatgagacagttctgggttcgaatact |
28966087 |
T |
|
| Q |
201 |
tatatcggttccttcacttgcaccctagtttagtttc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28966086 |
tatatcggttccttcacttgcaccctagtttagtttc |
28966050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University