View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18866_low_12 (Length: 263)
Name: NF18866_low_12
Description: NF18866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18866_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 15 - 171
Target Start/End: Complemental strand, 2117397 - 2117241
Alignment:
| Q |
15 |
tgaaaccaaattagtagattatgttcacttttcgttttttgatacaaattccaattcaattcgttggccggtgtgctataaacaagtttaccccaagttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2117397 |
tgaaaccaaattagtagattatgttcacttttcgttttttgatacaaattccaattcaattcgttggccggtgtgctataaacaagtttaccccaagttt |
2117298 |
T |
 |
| Q |
115 |
acatagaatatagttttcatttgcaattgcaagttgcaacaactcatataatgcaaa |
171 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2117297 |
acatagaatatagttttcatttgccattgcaagttgcaacaactcatataatgcaaa |
2117241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 191 - 255
Target Start/End: Complemental strand, 2117251 - 2117186
Alignment:
| Q |
191 |
tataatgcaaa-gccaagtgcacaagacaaagattaaaattgccctattaaactattaatattgaa |
255 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
2117251 |
tataatgcaaaagccaagtgcacaagacaaagattaaaattggcctattaaactattattattgaa |
2117186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University