View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18866_low_14 (Length: 240)
Name: NF18866_low_14
Description: NF18866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18866_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 20 - 227
Target Start/End: Complemental strand, 34344892 - 34344685
Alignment:
| Q |
20 |
gatgctgtggagatgattcgagcacaattaggccttgttgcacctcatcatcatgttcactttctagtccttgatgtctcagatgctgattctattcaaa |
119 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34344892 |
gatgctgtggagagaattcgagcacaattaggccttgttgcacctcatcatcatgttcactttctagtccttgatgtctcagatgctgattctattaaaa |
34344793 |
T |
 |
| Q |
120 |
cctttgcatcctccttcaaagacaaatttggagccaccttggatattctcgtatgtattaattacctattacttgttcaattttaatttttacatcattt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34344792 |
cctttgcatcctccttcaaagacaaatttggagccaccttggatattctcgtatgtattaattacctattatttgttcaattttaatttttacatcattt |
34344693 |
T |
 |
| Q |
220 |
ggattgat |
227 |
Q |
| |
|
|||||||| |
|
|
| T |
34344692 |
ggattgat |
34344685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University