View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18866_low_18 (Length: 220)
Name: NF18866_low_18
Description: NF18866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18866_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 20 - 186
Target Start/End: Original strand, 52088247 - 52088412
Alignment:
| Q |
20 |
cgatgttagttcatgtactaactaactgatgactagatctcataatagtgtatttggaaaactttgtgtgtatatgatttatatcatattactnnnnnnn |
119 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52088247 |
cgatgttagttcatgtagtaact----gatgactagatctcataatggtgtatttggaaaactttgtgtgtgtatgatttatatcatattactattatca |
52088342 |
T |
 |
| Q |
120 |
nnnnnnnnnn---taatattgttatttgtattgctatcactcaaaccgggtgctttgtgtctgtttgtcc |
186 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||| ||||||||||||||||| |
|
|
| T |
52088343 |
tcatcatcatcattaatattgttatttgtattgctatcactaaaacggggtgttttgtgtctgtttgtcc |
52088412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University