View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18866_low_5 (Length: 321)
Name: NF18866_low_5
Description: NF18866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18866_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 16 - 245
Target Start/End: Original strand, 40508125 - 40508354
Alignment:
| Q |
16 |
atatagaggagagtaatgaagttatttcaaattataatattccatatagttttctatatgtcatgatatatttgacatctttctaaaagtttgtctctta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40508125 |
atatagaggagagtaatgaagttatttcaaattataatattccatatagttttctatatgtcatgatatatttgacatctttctaaaagtttgtctctta |
40508224 |
T |
 |
| Q |
116 |
tatttaacaaatgataacaaacatcatctctaaattaatgacaaaaaacattattttcgaaattgtctgtatgcaaaagtagattaatgttatcatatat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40508225 |
tatttaacaaatgataacaaacatcatctctaaattaatgacaaaaaacattattttcgaaattgtctgtatgcaaaagtagattaatgttatcatatat |
40508324 |
T |
 |
| Q |
216 |
atcaaattaattagggctattgcacaatag |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40508325 |
atcaaattaattagggctattgcacaatag |
40508354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 257 - 304
Target Start/End: Original strand, 40508394 - 40508441
Alignment:
| Q |
257 |
tatccaaaacatgcatgtgcacaaacagtttttgttattgctaaattg |
304 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40508394 |
tatccaaaacattcatgtgcacaaactgtttttgttattgctaaattg |
40508441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University