View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18868_high_15 (Length: 255)
Name: NF18868_high_15
Description: NF18868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18868_high_15 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 53 - 255
Target Start/End: Complemental strand, 52914802 - 52914600
Alignment:
| Q |
53 |
gtagttgaaaattaaagtagttggacccaaacaccctgacttggaacttcttgatggaccacaaatagtaaataatatcccggaggtgcaagaatgggtg |
152 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52914802 |
gtagttgaaaattagagtagttggacccaaacaccctgacttggaacttcttgatggaccacaaatagtaaataatatcccggaggtgcaagaatgggtg |
52914703 |
T |
|
| Q |
153 |
aatttggtattgccacttcaacttggtatgttgatgtcgattctccaacaacatttttactactactcaattcatcaagcaccaacaacctttgattcat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52914702 |
aatttggtattgccacttcaacttggtatgttgatgtcgattctccaacaacatttttactactactcaattcatcaagcaccaacaacctttgattcat |
52914603 |
T |
|
| Q |
253 |
tga |
255 |
Q |
| |
|
||| |
|
|
| T |
52914602 |
tga |
52914600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 57 - 154
Target Start/End: Complemental strand, 7571646 - 7571549
Alignment:
| Q |
57 |
ttgaaaattaaagtagttggacccaaacaccctgacttggaacttcttgatggaccacaaatagtaaataatatcccggaggtgcaagaatgggtgaa |
154 |
Q |
| |
|
||||||||||||||| ||| | ||||| || | ||| |||| ||||| ||| ||||||||||||| |||| |||| ||||| |||||||| |||||| |
|
|
| T |
7571646 |
ttgaaaattaaagtatttgtatccaaattccttcactaggaatttctttatgaaccacaaatagtagataaaatccaggaggcgcaagaataggtgaa |
7571549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University