View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18868_high_18 (Length: 246)

Name: NF18868_high_18
Description: NF18868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18868_high_18
NF18868_high_18
[»] chr8 (2 HSPs)
chr8 (18-163)||(20097641-20097794)
chr8 (182-235)||(20097591-20097644)


Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 18 - 163
Target Start/End: Complemental strand, 20097794 - 20097641
Alignment:
18 cattctatggaagctgcctccctcctgtaatcctcgtgaaactggcgacgagatggtgatcgttggcgtccgctattggccgacgcg--------ttcaa 109  Q
    ||||||||||||| |||||||||||||||||||||||||||| |||||||||| ||||||||||| ||||| |||||||||||||||        |||||    
20097794 cattctatggaagttgcctccctcctgtaatcctcgtgaaaccggcgacgagagggtgatcgttgtcgtcctctattggccgacgcggaacacacttcaa 20097695  T
110 acccgcgatcctagtcgtcctcatgtgaacctgccgtaaccctaaccatatcct 163  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20097694 acccgcgatcctagtcgtcctcatgtgaacctgccgtaaccctaaccatatcct 20097641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 182 - 235
Target Start/End: Complemental strand, 20097644 - 20097591
Alignment:
182 tccttccgccgtgccgtttgctctccctttgcctgtcctaatcactatcttcat 235  Q
    |||||| ||||||| ||||||||||||||||| |||||||||||||||||||||    
20097644 tccttctgccgtgctgtttgctctccctttgcttgtcctaatcactatcttcat 20097591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University