View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18868_high_18 (Length: 246)
Name: NF18868_high_18
Description: NF18868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18868_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 18 - 163
Target Start/End: Complemental strand, 20097794 - 20097641
Alignment:
| Q |
18 |
cattctatggaagctgcctccctcctgtaatcctcgtgaaactggcgacgagatggtgatcgttggcgtccgctattggccgacgcg--------ttcaa |
109 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| |||||||||| ||||||||||| ||||| ||||||||||||||| ||||| |
|
|
| T |
20097794 |
cattctatggaagttgcctccctcctgtaatcctcgtgaaaccggcgacgagagggtgatcgttgtcgtcctctattggccgacgcggaacacacttcaa |
20097695 |
T |
 |
| Q |
110 |
acccgcgatcctagtcgtcctcatgtgaacctgccgtaaccctaaccatatcct |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20097694 |
acccgcgatcctagtcgtcctcatgtgaacctgccgtaaccctaaccatatcct |
20097641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 182 - 235
Target Start/End: Complemental strand, 20097644 - 20097591
Alignment:
| Q |
182 |
tccttccgccgtgccgtttgctctccctttgcctgtcctaatcactatcttcat |
235 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20097644 |
tccttctgccgtgctgtttgctctccctttgcttgtcctaatcactatcttcat |
20097591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University