View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18868_high_7 (Length: 401)
Name: NF18868_high_7
Description: NF18868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18868_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 383; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 383; E-Value: 0
Query Start/End: Original strand, 1 - 395
Target Start/End: Complemental strand, 39809177 - 39808783
Alignment:
| Q |
1 |
tcgctgcagccgccaccctttgctgctcttcaacggtggtagaagcgccaccaccggtggatagtatagcctcaaggtagccattaatccactcattacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39809177 |
tcgctgcagccgccaccctttgctgctcttcaacggtggtagaagcaccaccaccggtggatagtatagcctcaaggtagccattaatccactcattacc |
39809078 |
T |
|
| Q |
101 |
agccattaatctcaacctttctttgtattatatatgtaatgtaaaactactatacagtttacaatattcttaaactcaagtactcattctaatatgaagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39809077 |
agccattaatctcaacctttctttgtattatatatgtaatgtaaaactactatacagtttacaatattcttaaactcaagtactcattctaatatgaagt |
39808978 |
T |
|
| Q |
201 |
atgtttcttgaatgttacatgatcaacatggcttatctttatgtaatgttttgtgtgcagtgttagagaaccacatgcaatgaacgatgtatattgctca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39808977 |
atgtttcttgaatgttacatgatcaacatggcttatctttatgtaatgttttgtgtgcagtgttagagaaccacatgcaatgaacgatgtatattgctca |
39808878 |
T |
|
| Q |
301 |
tttttggttcaaatttgtgtgttgtgtattgtattgtcttttgtgttagttagttaggcaccgaatataattaacattattccttattcatctca |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39808877 |
tttttggttcaaatttgtgtgttgtgtattgtgttgtcttttgtgttagttagttaggcaccgaatataattaacattattccttattcttctca |
39808783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University