View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18868_low_18 (Length: 248)
Name: NF18868_low_18
Description: NF18868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18868_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 20 - 212
Target Start/End: Original strand, 2018395 - 2018587
Alignment:
| Q |
20 |
acacttatacctcgctgtgaacaagaacaaccatggaatcactacctgacgacgttctgtatcacattctgtcgttccttccgacgagggatgctgttgc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2018395 |
acacttatacctcgctgtgaacaagaacaaccatggaatcactacctgacgacgttctgtgtcacattctgtcgttccttccgacgagggatgctgttgc |
2018494 |
T |
|
| Q |
120 |
tactagccttctgtcaaagagatggaaaccactctggctctccctccgttccttcgaccttgatgacaactacttttccgacttccacaggtt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2018495 |
tactagccttctgtcaaagagatggaaaccactctggctctccttccgttccttcgaccttgatgacaactacttttccgacttccacaggtt |
2018587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 61 - 176
Target Start/End: Original strand, 2005585 - 2005700
Alignment:
| Q |
61 |
ctacctgacgacgttctgtatcacattctgtcgttccttccgacgagggatgctgttgctactagccttctgtcaaagagatggaaaccactctggctct |
160 |
Q |
| |
|
||||||||||| ||| | |||||||||||| | |||||||||||| ||||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2005585 |
ctacctgacgatcttcgatgtcacattctgtcatgccttccgacgagagatgcgtctgctactagccttctgtcaaagagatggaaaccactttggctct |
2005684 |
T |
|
| Q |
161 |
ccctccgttccttcga |
176 |
Q |
| |
|
| |||||||||||||| |
|
|
| T |
2005685 |
cactccgttccttcga |
2005700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 64 - 173
Target Start/End: Original strand, 2011762 - 2011871
Alignment:
| Q |
64 |
cctgacgacgttctgtatcacattctgtcgttccttccgacgagggatgctgttgctactagccttctgtcaaagagatggaaaccactctggctctccc |
163 |
Q |
| |
|
|||||||| |||| || ||||||||| || |||||||| ||||| ||||||| |||||| || ||||| |||||||||||||||||||| |||||||| | |
|
|
| T |
2011762 |
cctgacgatgttcggtgtcacattctctcattccttccaacgagagatgctgctgctacaagtcttctatcaaagagatggaaaccactttggctctcgc |
2011861 |
T |
|
| Q |
164 |
tccgttcctt |
173 |
Q |
| |
|
|||||||||| |
|
|
| T |
2011862 |
tccgttcctt |
2011871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University