View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18868_low_23 (Length: 237)

Name: NF18868_low_23
Description: NF18868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18868_low_23
NF18868_low_23
[»] chr3 (1 HSPs)
chr3 (1-221)||(52914281-52914501)


Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 52914501 - 52914281
Alignment:
1 cgtatttcaatttcgtttgtgattggggtgcaggaaacaccattataggacgcacatcattgaatcctaactctaaatacgaaggtgaaaaagcttctaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||    
52914501 cgtatttcaatttcgtttgtgattggggtgcaggaaacaccattataggacgcacatcattgaatcccaactctaaatacgaaggtgaaaacgcttctaa 52914402  T
101 ccgaagttcagttggaaacaaacgagtaaaattgtaatttacatgagggttgctaccggcaacaagaaccctaccgtctcgtagcaaaacagcagttgaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52914401 ccgaagttcagttggaaacaaacgagtaaaattgtaatttacatgagggttgctaccggcaacaagaaccctaccgtctcgtagcaaaacagcagttgaa 52914302  T
201 tggtacattcgtggaatatca 221  Q
    |||||||||||||||||||||    
52914301 tggtacattcgtggaatatca 52914281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University