View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18868_low_25 (Length: 235)
Name: NF18868_low_25
Description: NF18868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18868_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 23 - 196
Target Start/End: Original strand, 14438832 - 14439005
Alignment:
| Q |
23 |
cttgtacattattcatgtgttgtgacaagtaacttttccaaaaagaattgtatatcttagttaaaaaatgtacatttgcatccctttggagataaaatct |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14438832 |
cttgtacattattcatgtgttgtgacaagtaacttttccaaaaagaattgtatatcttggttaaaaaatgtacatttgcatccctttggagataaaatct |
14438931 |
T |
|
| Q |
123 |
ttgatgagcacaaccccaaattaaaatgatttaagcacatttacaaaacatnnnnnnntaattgatgtgattga |
196 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||| ||||| ||||||||||| |||||||||||||||| |
|
|
| T |
14438932 |
ttgatgagcataaccctaaattaaaatgatttgggcacacttacaaaacataaaaaaataattgatgtgattga |
14439005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 116 - 154
Target Start/End: Complemental strand, 40835587 - 40835549
Alignment:
| Q |
116 |
aaaatctttgatgagcacaaccccaaattaaaatgattt |
154 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
40835587 |
aaaatcttagatgagcacaaccccaaatcaaaatgattt |
40835549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University