View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18869_high_7 (Length: 260)

Name: NF18869_high_7
Description: NF18869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18869_high_7
NF18869_high_7
[»] chr7 (2 HSPs)
chr7 (18-163)||(47489419-47489564)
chr7 (156-257)||(47489293-47489394)


Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 163
Target Start/End: Complemental strand, 47489564 - 47489419
Alignment:
18 cgttcttcatatataataaattttcagttagattttctttgtttaatagagggatgattaattatacaccgttgtatggtttatgcgatcaacataatga 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
47489564 cgttcttcatatataataaattttcagttagattttctttgtttaatagagggatgattaattatacaccgttgtattgtttatgcgatcaacataatga 47489465  T
118 aacgatttatcatccatctttctatgaagtgtgacgggtccagggc 163  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
47489464 aacgatttatcatccatctttctatgaagtgtgacgggtccagggc 47489419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 156 - 257
Target Start/End: Complemental strand, 47489394 - 47489293
Alignment:
156 tccagggctggttggtgacaaatacagtattggatagcaggttcactgagtggctgtaacatgtcattatgcagactgataatgaaataattcaagtggt 255  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47489394 tccagggctggttggtgacaaatacagtattggatagcaggttcactgagtggctgtaacatgtcattatgcagactgataatgaaataattcaagtggt 47489295  T
256 at 257  Q
    ||    
47489294 at 47489293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University