View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18869_high_7 (Length: 260)
Name: NF18869_high_7
Description: NF18869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18869_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 163
Target Start/End: Complemental strand, 47489564 - 47489419
Alignment:
| Q |
18 |
cgttcttcatatataataaattttcagttagattttctttgtttaatagagggatgattaattatacaccgttgtatggtttatgcgatcaacataatga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47489564 |
cgttcttcatatataataaattttcagttagattttctttgtttaatagagggatgattaattatacaccgttgtattgtttatgcgatcaacataatga |
47489465 |
T |
|
| Q |
118 |
aacgatttatcatccatctttctatgaagtgtgacgggtccagggc |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47489464 |
aacgatttatcatccatctttctatgaagtgtgacgggtccagggc |
47489419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 156 - 257
Target Start/End: Complemental strand, 47489394 - 47489293
Alignment:
| Q |
156 |
tccagggctggttggtgacaaatacagtattggatagcaggttcactgagtggctgtaacatgtcattatgcagactgataatgaaataattcaagtggt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47489394 |
tccagggctggttggtgacaaatacagtattggatagcaggttcactgagtggctgtaacatgtcattatgcagactgataatgaaataattcaagtggt |
47489295 |
T |
|
| Q |
256 |
at |
257 |
Q |
| |
|
|| |
|
|
| T |
47489294 |
at |
47489293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University