View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18870_low_7 (Length: 220)

Name: NF18870_low_7
Description: NF18870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18870_low_7
NF18870_low_7
[»] chr1 (1 HSPs)
chr1 (1-193)||(28959526-28959718)


Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 28959718 - 28959526
Alignment:
1 gaagtattggatctaacatgcagaattattatgttaagagttgcaaacactgcctcttttctttgagtgcagtgcaagccaaataaggtaactcataatt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
28959718 gaagtattggatctaacatgcagaattattatgttaagagttgcaaacactggctcttttctttgagtgcagtgcaagccaaataaggtaactcataatt 28959619  T
101 tataattattcatggaaacgtgaactattattctgcaacccattgtatacataatttagtatcattattaatgttagtatatattggccctac 193  Q
    | ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||    
28959618 tgtaattattcatggaaacgtgaactattattctgcaacccattgcatacataatttagtatcattattaatgttagtatttattggccctac 28959526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University