View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18873_high_12 (Length: 307)
Name: NF18873_high_12
Description: NF18873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18873_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 85 - 166
Target Start/End: Complemental strand, 6913866 - 6913784
Alignment:
| Q |
85 |
gtagagatcgttggtgttgataaa-tactaataaaacttttctcatgaatcatgtttttgtaacagaactcggttttccacaa |
166 |
Q |
| |
|
||||||||||||||| |||||||| |||||||| ||| ||||||||||||||||||||||||| | ||||| ||||||||||| |
|
|
| T |
6913866 |
gtagagatcgttggttttgataaaatactaatacaacatttctcatgaatcatgtttttgtaaaataactcagttttccacaa |
6913784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 191 - 230
Target Start/End: Complemental strand, 6913738 - 6913699
Alignment:
| Q |
191 |
ctgataattttattttctagaacatctctcgtttccaacc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6913738 |
ctgataattttattttctagaacatctctcgtttccaacc |
6913699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University