View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18873_high_12 (Length: 307)

Name: NF18873_high_12
Description: NF18873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18873_high_12
NF18873_high_12
[»] chr3 (2 HSPs)
chr3 (85-166)||(6913784-6913866)
chr3 (191-230)||(6913699-6913738)


Alignment Details
Target: chr3 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 85 - 166
Target Start/End: Complemental strand, 6913866 - 6913784
Alignment:
85 gtagagatcgttggtgttgataaa-tactaataaaacttttctcatgaatcatgtttttgtaacagaactcggttttccacaa 166  Q
    ||||||||||||||| |||||||| |||||||| ||| ||||||||||||||||||||||||| | ||||| |||||||||||    
6913866 gtagagatcgttggttttgataaaatactaatacaacatttctcatgaatcatgtttttgtaaaataactcagttttccacaa 6913784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 191 - 230
Target Start/End: Complemental strand, 6913738 - 6913699
Alignment:
191 ctgataattttattttctagaacatctctcgtttccaacc 230  Q
    ||||||||||||||||||||||||||||||||||||||||    
6913738 ctgataattttattttctagaacatctctcgtttccaacc 6913699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University