View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18873_high_17 (Length: 250)
Name: NF18873_high_17
Description: NF18873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18873_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 79 - 227
Target Start/End: Original strand, 8526371 - 8526515
Alignment:
| Q |
79 |
atatgttttcattattattttcttaggttacaaacttccaattccatcatatagtgttgttttttatagcccttttttgtattaacctgagaaagtagag |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8526371 |
atatgttttcattattattttcttaggttacaaacttc----ttcatcatatagtgttgttttttatagcacttttttgtattaacctgagaaagtagag |
8526466 |
T |
 |
| Q |
179 |
ttgtaaataacgtgcatgggtgcttaatgcggattttggaaaaatgata |
227 |
Q |
| |
|
||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8526467 |
ttgcaaataacgtgcatgggtgcttaatgcgaattttggaaaaatgata |
8526515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 41 - 111
Target Start/End: Original strand, 9441509 - 9441579
Alignment:
| Q |
41 |
tgtatatgtgaagttgatcgaagtaatgatacatgtcaatatgttttcattattattttcttaggttacaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9441509 |
tgtatatgtgaagttgatcgaagtaatgatgcatgtagatatgttttcattattattttcttaggttacaa |
9441579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University